Details of this Paper

Genetics DNA




1) Fifteen Neurospora mutants were isolated that are unable to grow in the absence of cysteine. The pathway;for the synthesis of this amino acid is as follows;5-methyltetrahydropteroyltri-L-glutamate;methionine;S-adenosyl-L-methionine;S-adenosyl-L-homocysteine;homocysteine;crystathionine;cysteine;The mutants were divided into 6 groups based on complementation tests: cys-1, cys-2, cys-3, cys-4, cys-5 and;cys-6. A member of each was tested for its ability to grow on minimal media supplemented with a compound;in the synthetic pathway with the following results.;MM + SMinimal;MM + SMM +;MM +;adenoysl-LMM +;MM +;Mutant media;adenosyl-Lcysteine methionine;homocystei homocysteine cystathionine;(MM);methionine;ne;no;cys-1;growth;growth;growth;growth;growth;growth;growth;no;cys-2;growth;no growth;no growth;no growth;no growth;no growth;growth;no;cys-3;growth;no growth;growth;growth;growth;growth;growth;no;cys-4;growth;no growth;no growth;no growth;growth;growth;growth;no;cys-5;growth;no growth;no growth;growth;growth;growth;growth;no;cys-6;growth;no growth;no growth;no growth;no growth;growth;growth;On the diagram above identify the step that requires the wild-type gene corresponding to the mutants cys-1;through 6.;2. A lab class repeated the experiments of Yanovsky and generated hundreds of mutations in the trpA gene;with EMS which causes base substitution mutants. The sequenced each of the mutants and found that three;(57, 92, 98) resulted in a change in the same amino acid of the protein at position 234. The DNA sequences of;the region containing the mutations are below;wild-type;CAAAGGCATTGATGAGTTTT;57;CAAAGGCCTTGATGAGTTTT;92;CAAAGGCATGGATGAGTTTT;98;CAAAGGCGTTGATGAGTTTT;(a) What the sequence of this region in wild-type and the three mutants? Highlight the amino acid changed in;the wild-type and the one it is changed to in the mutants.;(b) If Yanovsky had obtained these mutations would he have been able to extend conclusions he made about;the genetic code?;(c) When the students in the lab class tried to repeat the experiment of crossing two mutants together to;generate a recombinant that is wild-type, they were successful after crossing two pairs, but not with the other;pair. Which pair was unsuccessful and why?;3) Several new mutations in the rIIB gene of phage T4 were generated with proflavin. The sequence of four;mutants is shown below along with the wild-type, only part of the sequence is shown, the first base shown in;the wild-type is in frame.;Wild-type;GATGCAGTTATTGCTCCAGTTGCTAAATCTGACATTATT;M15;GATGCACAGTTATTGCTCCAGTTGCTAAATCTGACATTATT;M77;GATGCAGTTATTGCTCCAGTTGCTAAATCTCATTATT;G66;GATGCAGTTATTGCTCCAGTTGCTAAATCTGACGATTATT;G90;GATGCAGTTATTGCCCAGTTGCTAAATCTGACATTATT;G122;GATGCACCTATTGCTCCAGTTGCTAAATCTGACATTATT;(a) Identify the changes in nucleotide sequence in each of the mutants. Is each of these what is expected with;proflavin mutagenesis?;(b) If the mutants were crossed to each other, which ones could yield recombinants with wild-type phenotype;and grow on E. coli strain K12?;(c) What is the sequence of the region shown in wild-type, what could the sequence of this region of the;protein be in the wild-type recombinants?;(d) Why might the recombinants you identified in (b) not be wild-type? Which of these recombinants is most;likely not to be wild-type?;4) Different temperature sensitive mutants of E. coli in genes encoding proteins involved in transcription were;grown at the permissive temperature for several generations and while still actively growing the temperature;was raised to the restrictive temperature. After raising temperature, the synthesis of new RNA was assessed;using radioactively labeled nucleotides. Assume the mutations completely inactivate the proteins at the;restrictive temperature and that function of the mutant protein was abolished instantly temperature was raised.;What would happen to the level of new RNA synthesized in the following mutants after raising the;temperature? Explain your answers.;(4 points each);(a) Sigma factor;(b) Subunit of RNA polymerase;(c) Rho protein;5) Below is the sequence of an mRNA;GAUAUAUGCGCGAUGGGUGAAAACGAGACUAUUUGCUCGAUUUCAGAGGCAUCCUAUUAAUGACGGUAAUUAAAGCGCAAAAAAAAAAA;(a) Was this isolated from a eukaryote or a prokaryote?;(b) What was the sequence of the template strand in the genomic DNA used to synthesize this molecule.;Write the sequence as is conventional for a single stranded DNA strand.;(c) What is the sequence of the protein translated from this mRNA?


Paper#15100 | Written in 18-Jul-2015

Price : $37