Details of this Paper

define organic molecules




Microbiology questions 2,3,6,7,9.doc Download Attachment;Chapter 2;1. For our purposes, we will define organic molecules as those molecules that are complex and contain C;and H. (Think of C and H sugar as organic). Inorganic molecules are relatively simple in structure and;can contain C or H, but not C and H in the same molecule. Classify the following molecules as organic;or inorganic;a) H2O (water);b) O2 (oxygen);c) C18H29SO3 (styrofoam);d) FeO (iron oxide);e) C2H6O (ethanol);2. Name 3 additional inorganic compounds.;a.;b.;c.;3. What atoms must be present in a molecule for it to be considered organic?;1. What characteristics of carbon make it ideal for the formation of organic compounds?;2. What are functional groups?;3. Differentiate between a monomer and a polymer.;4. How are polymers formed?;4. What characterizes the carbohydrates?;1. Differentiate between mono-, di-, and polysaccharides, and give examples of each.;Page 1 of 28;2. What are some of the functions of polysaccharides in the cell?;5. Draw simple structural molecules of triglycerides and phospholipids to compare their similarities and;differences.;1. How are saturated and unsaturated fatty acids different?;2. What characteristic of phospholipids makes them essential components of cell membranes?;3. Why is the hydrophilic end of phospholipids attracted to water?;6. Describe or draw the basic structure of an amino acid.;1. What makes the amino acids distinctive, and how many of them are there?;2. What is a peptide bond?;3. Differentiate between a peptide, a polypeptide, and a protein.;4. Explain what causes the various levels of structure of a protein molecule.;5. What functions do proteins perform in a cell?;Page 2 of 28;7. Describe and/or draw a nucleotide and a polynucleotide, and compare and contrast the general structure;of DNA and RNA.;Chapter 3;Microbiology;Chapter 3-Cell Structure and Function;Why is it important to;study cells?;Describe four major;processes of living cells.;Processes of Life;1.;2.;3.;4.;Compare and contrast;prokaryotic and;eukaryotic cells by;providing at least 3;similarities and 3;differences.;Prokaryotic and Eukaryotic Cells: An Overview;Similarities;Differences;External Structures of Bacterial Cells;Glycocalyces;Describe the;composition, function;and relevance to human;health of glycocalyces.;Distinguish capsules;from slime layers.;Flagella;Page 3 of 28;Discuss the structure and;function of bacterial;flagella.;Fimriae and Pili;Compare and contrast the Structure;structures and functions;Fimbriae;of fimbriae, pili and;Pili;flagella.;Flagella;Similarities;Function;Differences;Bacterial Cell Walls;Describe common shapes;and arrangements of;bacterial cells.;Describe the sugar and;peptide portions of;peptidoglycan.;Compare and contrast the;cell walls of Grampositive and Gramnegative bacteria in terms;of structure and Gram;staining;Highlight green box;What are biofilms and;how do they impact;human health?;Biofilms: Slime Matters;Gram-Positive Bacteria Cell Walls;Compare and contrast the;cell walls of acid-fast;bacteria with typical;Gram-positive cell walls.;Gram-Negative Bacteria Cell Walls;Describe the clinical;Page 4 of 28;implications of the;structure of the Gramnegative cell wall.;CRITICAL THINKING;After a man infected with the bacterium Escherichia coli was treated;with the correct antibiotic for this pathogen, the bacterium was no;longer found in the man's blood, but his symptoms of fever and;inflammation worsened. What caused the man's response to the;treatment? Why was his condition worsened by the treatment?;Bacterial Cytoplasmic Membranes;Structure;Diagram a phospholipid;bilayer, and explain its;significance in reference;to a cytoplasmic;membrane.;Explain the fluid mosaic;model of membrane;structure.;Function;Describe the functions of;a cytoplasmic membrane;as they relate to;permeability.;Compare and contrast the;passive and active;processes by which;materials cross a;cytoplasmic membrane.;Page 5 of 28;Define osmosis, and;distinguish among;isotonic, hypertonic, and;hypotonic solutions.;CRITICAL THINKING;Osmotic pressure;Solutions hypertonic to bacteria and fungi are used for food;preservation. For instance, jams and jellies are hypertonic with sugar;and pickles are hypertonic with salt. How do hypertonic solutions kill;bacteria and some fungi that would otherwise spoil these foods?;Cytoplasm of Bacteria;Describe bacterial;cytoplasm and its basic;contents.;What is a nucleoid?;How is a bacterial;chromosome different;than a human one?;Endospores;Briefly describe the;structure and function of;endospores.;What are the two main;genera of bacteria that;produce endospores?;Why are endospores;clinically significant?;CRITICAL THINKING;Following the bioterrorist anthrax attacks in the fall of 2001, a news;commentator suggested that people steam their mail for 30 seconds;before opening it. Would the technique protect people from anthrax;infections? Why or Why not?;Nonmembranous Organelles;Describe the structure;and function of;Page 6 of 28;ribosomes.;Why are ribosomes;clinically significant?;Describe 3 similarities;between eukaryotic and;prokaryotic cells.;Structure of Eukaryotic Cells vs. Prokaryotic Cells;1.;2.;3.;Describe 3 differences;between eukaryotic and;prokaryotic cells.;1.;2.;3.;Endosymbiotic Theory;Describe the;endosymbiotic theory of;the origin of;mitochondria and;eukaryotic cells.;List evidence that;supports the;endosymbiotic theory.;Draw the 3 major;bacterial shapes.;From Chapter 11;Morphology of Prokaryotic Cells;1. coccus=;2. bacillus=;3. spirals=;What is a vibrio?;What is a coccobacillus?;What is pleomorphism?;What is the difference;between the use of the;term bacillus and the;Page 7 of 28;name Bacillus?;Staphylococcus and;staphylococcus?;What do the terms;strepto- and staphylomean?;Reproduction of Prokaryotic Cells;Describe binary fission.;How is this different;from mitosis?;Microbiology;Chapter 6-Microbial Nutrition and Growth;1. Describe the roles of carbon, hydrogen, oxygen, nitrogen, trace elements, and vitamins in;microbial growth and reproduction.;2. Compare the four basic categories of organisms based on their carbon and energy sources.;3. Distinguish among anaerobes, aerobes, aerotolerant anaerobes, facultative anaerobes and;microaerophiles.;4. Explain how oxygen can be fatal to organisms by discussing singlet oxygen, superoxide;radical, peroxide anion, and hydroxyl radical.;5. Explain how organisms protect themselves from toxic forms of oxygen.;6. Define nitrogen fixation, and explain its importance.;7. Explain how extremes of temperature, pH, and osmotic and hydrostatic pressure limit;microbial growth.;8. Describe how quorum sensing can lead to formation of a biofilm.;9. Describe methods for collecting clinical specimens from the skin and from the respiratory;reproductive, and urinary tracts.;10. Describe the two most common methods by which microorganisms can be isolated for;culture.;11. Describe six types of general culture media available for bacterial culture.;12. Discuss the use of special culture methods, including animal and cell culture, low-oxygen;culture, and enrichment culture.;13. Contrast refrigeration, deep freezing, and lyophilization as methods for preserving cultures;of microbes.;14. Define logarithmic growth.;Page 8 of 28;15. Explain what is meant by the generation time of bacteria.;16. Draw and label a bacterial growth curve.;17. Describe what occurs at each phase of a population's growth.;18. Compare and contrast direct and indirect methods of measuring bacterial reproduction.;Chapter 7;Microbiology;Chapter 7-Microbial Genetics;The Structure and Replication of Genomes;Define genome.;Define gene.;What is the relationship;between genes and genome?;What does DNA stand for?;The Structure of Nucleic Acids;Nucleic acids, like DNA and The monomers(building block) of DNA are deoxyribose;RNA, are polymers;nucleotides. Nucleotides are composed of 3 different parts;composed of monomer;(refer to pg. 202, Fig. 7.4a);subunits(building blocks).;1. Nitrogenous base-shown in teal as a guanine base (note the;many nitrogens);2. Sugar molecule-DNA has deoxyribose-shown in purple;3. Phosphate-shown as a PO4 group that is repeated 3 times;however note in Fig. 7.4b that 2 of the phosphates are cut to;release their energy when the monomers are used in an anabolic;reaction.;There are 4 types of DNA;What are the 4 types of DNA nucleotides?;nucleotides that bind in a;1.;specific complementary;2.;fashion (called base pairing). 3.;4.;Which bases bind together?;There are 4 types of RNA;nucleotides that bind in a;specific complementary;fashion.;What are the 4 types of RNA nucleotides?;1.;2.;3.;4.;Which bases bind together?;Page 9 of 28;What is the difference;between RNA and DNA?;You will see some similar;questions in the genetics lab;handout but a little repetition;can be helpful.;Note: do not worry about;the 5 and 3 terminology.;Briefly describe the 2 ways;that DNA structure helps;explain its ability to act as;genetic material.;Refer to Fig. 7.1 (d) and note the basic structure of DNA and;how the individual nucleotides are put together. It reminds me;of a spiral staircase with the sides of the staircase as the;backbone of DNA" which is alternating units of phosphate;and deoxyribose(sugar) covalently bonded together. The stair;steps of the staircase are the nitrogenous bases which are;complementary bound to one another through weak hydrogen;bonds.;This refers to a specific carbon atom, but we will not have to;get that detailed for our purposes.;1.;2.;CRITICAL THINKING;The chromosome of Mycobacterium tuberculosis is;4,411,529 bp long. A scientist who isolates and counts the;number of nucleotides in it DNA molecule discovers that;there are 2,893,963 molecules of guanine. How many;molecules of the other three nucleotides are in the original;DNA?;How many base pairs are;found in Escherichia coli?;How many base pairs are;found in human?;1. E. coli base pairs=;2. Human base pairs=;How long in meters is the entire human genome?;When human DNA is packed into a nucleus it's like packing;45 miles of thread in to a ___________ _____________.;The Structure of Prokaryotic Genomes;A typical prokaryotic;chromosome is one single;circle of DNA found in what;region of the cell?;Briefly describe the structure;of a plasmid.;Are the genes carried on;Page 10 of 28;plasmids essential for normal;growth?;Explain the types of genes;Types of genes;and specific example of;Resistance plasmids;Specific example;Explain the types of genes;and specific example of;Virulence plasmids;Types of genes;Specific example;The Structure of Eukaryotic Genomes;Compare and contrast;prokaryotic and eukaryotic;chromosomes by stating 2;similarities and 2 differences;between them.;DNA Replication: Preserving the Code and Passing it On;Explain what is meant by the;term "semiconservative;replication". Are the new;strands identical to the;original segment of DNA?;Watch the ANIMATION;DNA Replication: Overview;and explain the process in;your own words.;The enzymes and processes;that you will be responsible;for are 1)helicase and;2)DNA polymerase III.;You will not need to worry about the other enzymes and;terms like lagging and leading strand, etc.;Using the terms helicase and DNA polymerase, explain;how DNA replication takes place;Replicate the following;TTCCAGTCATGCAAGGCTGTAACTGA;segment of DNA by writing;the complementary sequence;below the parent strand.;NOTE: the strands have;already been separated by;helicase.;Page 11 of 28;CRITICAL THINKING;Hydrogen bonds between complementary nucleotides are;crucial to the structure of dsDNA because they hold the two;strands together. Why couldn't the two strands be;effectively linked by covalent bonds?;Gene Function;The Relationship Between Genotype and Phenotype;Define genotype.;Define phenotype.;Explain the relationship;between genotype and;phenotype.;The Transfer of Genetic Information;State the central dogma of;genetics (refer to Fig. 7.8).;Define transcription.;Define translation.;How is the language of the;gene expressed? We need to;get from DNA to a;protein(since proteins are the;true workers of the cell).;How do we do it?;Watch the animations and In;your words summarize the;events in transcription using;the following words. 1);DNA, 2)promoter region;3)RNA polymerase, 4)RNA;nucleotides, 5)RNA;transcript, 6)termination site;Where does transcription;begin?;Where does transcription;The master code of ______ is first used to synthesize a copy;in the form of an ______ molecule via a process called;and the information contained in;the RNA is then used to produce ___________in a process;known as ______________________.;At the promoter site which acts like a green light to;transcribe a gene;At the terminator site which acts like a stop light to;Page 12 of 28;end?;There are four main types of;RNA but we'll only cover 3;of them which are;1. Messenger RNA (mRNA);2. ribosomal RNA (rRNA);3. transfer RNA (tRNA);transcribe a gene.;Fill in the blank with the type of RNA that matches the;definition;carries (transfers) the correct amino;acid to the ribosome to translate a protein from mRNA.;contains the message from DNA that;codes for a specific protein (that protein will have a specific;job in the cell);makes up the ribosome;CRITICAL THINKING;On average, RNA polymerase makes one error for every;10,000 nucleotides it incorporates in RNA. By contrast;only one base-pair error remains for every 10 billion base;pairs during DNA replication. Explain why the accuracy of;RNA transcription is not as critical as the accuracy of DNA;replication.;Read the Emerging Disease;Case Study: Vibrio;vulnificus Infection.;Did you know that a beach;could be so dangerous?;Translation;Explain the process of;translation.;What can ribosomes be;thought of as?;The Genetic Code;What is a codon?;How many codons exist?;What is a codon made of?;Describe the genetic code in;general and identify the;relationship between codons;and amino acids.;Page 13 of 28;What is an anticodon?;Does each codon have a;unique amino acid or is there;some redundancy?;CRITICAL THINKING;We have seen that wobble makes the genetic code redundant;in the third position of the codon for C and U. After;reexamining the genetic code in Fig. 7.12, state what other;nucleotides in the third position appear to accommodate;anticodon wobbling.;Describe the synthesis of;polypeptides, identifying the;roles of the 3 types of RNA.;What are the main;players in;translation? Refer to;Fig. 7.17;When the mRNA;transcript makes it to;the ribosome it is;threaded through the;ribosome just like;thread through the;eye of a needle.;The master genetic;code is the actual;code that us humans;can use to decode;nucleic acid language;into protein language;and vice versa.;What is the actual;link between nucleic;acid language and;protein language?;What are the;functions of start and;stop codons? Give;1. Ribosome (large and small subunit with rRNA thread);2. mRNA transcript;3. tRNAs with a SPECIFIC amino acid attached;What is the ribosome looking for on the mRNA transcript before it;can start translating the nucleic acid code into amino acids(protein)?;Hint: the green light to start translation called the start codon which;is ___________ (refer to Fig. 7.12);Note the different languages involved;1) DNA language written in triplets;2) mRNA written in codons;3) tRNA written in anticodons;4) protein language written in amino acids;Hint: what is the molecule called that has an RNA anticodon on one;end and an amino acid on the other end? Refer to Fig. 7.14;Page 14 of 28;examples of them.;Observe the strand of;nucleotides at right.;Is this DNA or RNA?;How do you know?;Use the genetic code;in Fig. 7.12 for the;following question.;Write the mRNA;strand out in the;blank. Write the;sequence of amino;acids coded for by;the mRNA strand.;GTCCTACGGCATCGGTACTAAA;GTCCTACGGCATCGGTACTAAA;Transcription;(mRNA);Translation;(amino acid);Briefly explain the;process of;translation using;the following terms;1)mRNA;2)ribosome;3)tRNA, 4)amino;acids, 5)codon;6)anticodon;DNA language;Each triplet of DNA can give rise to 1 _________ acid.;consists of 3;consecutive bases;called triplets.;If a protein is 3300;amino acids long;how many nucleotide;pairs long is the gene;sequence that codes;for it?;Regulation of Genetic Expression (pg. 213);Are genes on all the;time? Why or why;not?;Genetic regulation is quite complex and we will not cover it in depth.;I will be happy that you know that genes are turned on and off as;Page 15 of 28;What is iRNA?;needed(just like you turn lights on and off as needed), although some;genes are needed on all the time(just like the refrigerator is on all the;time.);Read the Highlight on pg.217, Flipping the switch: RNA;interference. It will come handy when we stream Dr. Baltimores;lecture on viruses and what his lab is doing to tackle AIDS.;MUTATIONS OF GENES;Define mutation.;List the 3 types of;effects of all;mutations and their;relative frequencies.;Type of Effect from;mutation;1. Harmful;2. Neutral;3. Beneficial;Frequency;1. most common;2. sometimes;3. least common but does;occur;Define point mutation.;Point mutations include;If you start with the;following DNA code and;separate it into 3 letter;words;If the DNA is mutated and;now reads what type of;change has happened?;If the DNA is mutated and;now reads what type of;change has happened?;If the DNA is mutated and;now reads what type of;change has happened?;Define frameshift mutation;and explain its possible;serious consequences.;What is a silent mutation and;give an example?;What is a missense mutation;and give an example?;What is a nonsense mutation;and give an example?;1. substitutions of 1 or more nucleotides;2. insertions of 1 or more nucleotides;3. deletions of 1 or more nucleotides;Original DNA =THECATATEELK;Original DNA =THE CAT ATE ELK;Mutated DNA= THE RAT ATE ELK;Change=;Mutated DNA= TRH ECA TAT EELK;Change=;Mutated DNA= TEC ATA TEE LK;Change=;Page 16 of 28;Briefly explain how a;mutation in DNA can;change a proteins;structure and/or;function.;Does our genetic;code, genotype, ever;change?;Yes, mutations naturally occur since our enzymes are not perfect;and this slight spontaneous genetic change is the driving force of;evolution but if there are too many of the wrong mutation in a;single human cell the result may be cancer.;Define mutagen.;Explain the;effects of;the;following;mutagens.;Mutagen;1.Physical=Ionizing;radiation (like X rays);Effects;2. Physical =Non-ionizing;radiation(like UV rays in;sunlight);3. Chemical =Nucleotide;analogs (like anti-viral or;anti-cancer drugs);4. Chemical=Frameshift;mutagens (like acridine);Can mutations be;fixed or repaired by;cells?;Define wild type;(wild strain) and;mutant strain..;Briefly describe the;purpose of the Ames;test?;Sometimes;Identifying Mutants, Mutagens and Carcinogens;Wild type strain=;Mutant strain=;The Ames Test;The Ames test exposes bacteria to potential mutagens and if a;specific mutagen can cause a mutation in bacteria it is further;tested in animal cells to see if it's indeed a carcinogen. Using;Page 17 of 28;bacteria allows researchers to screen many more potential;mutagens much faster.;Genetic Recombination and Transfer;Define;recombination.;Contrast vertical gene;transfer with;horizontal gene;transfer.;Genetic;Factors;Examples of genes transferred;Exchange;Involved;Mode;1. Conjugation A plasmid is;transferred;between 2;live cells;using a pilus;2.;A fragment;Transformatio of DNA;n;from a lysed;cell is;absorbed;by a live cell;3.;A;Transduction bacteriophag;e carries;DNA from;cell to cell;4.;A gene;Transposition jumps;from place;to place on a;plasmid or;chromosome;Define bacteriophage (also;called a phage).;Read the Clinical;Page 18 of 28;Application regarding;Deadly Horizontal Gene;Transfer on pg. 230. Answer;the questions below;Define nosocomial infection.;2. What is the likely source;of infection?;3. List 3 ways in which;1.;Enterococcus faecium might 2.;have acquired genes for drug 3.;resistance.;4. How could hospital;personnel prevent the spread;of resistant E. faecium;throughout the hospital?;Fill in the following table;Process;Purpose;Replication;Transcripti;on;Translation;Beginning;point;origin;Ending;point;End of;molecule;promoter;Synthesis of;polypeptides;(proteins);Explain the central dogma of;genetics.;Explain why DNA;polymerase is so named.;Vancomycin has been a powerful antibiotic against Grampositive bacterial infections since the 1950s. It has been;especially valuable against those bacteria that are resistant to;other commonly used antibiotics. For some bacterial strains;such as certain strains of Staphylococcus aureus that are;resistant to drugs like penicillin or methicillin, vancomycin;is the only drug that is still effective. The antibiotic works;by disrupting assembly of the bacterial cell wall.;Page 19 of 28;Since the 1980s, however, many strains of bacteria have;acquired resistance to vancomycin as well. In these bacteria;there is a mutation that changes the composition of the cell;wall. Vancomycin cannot attache to the modified cell wall;inthe mutant strain. Many patients infected with;vancomycin-resistant(VR) bacteria are essentially;untreatable, because these bacteria are often resistant to;other antibiotics as well.;1. What exactly is a;mutation.;2. How and why do;mutations occur?;Chapter 9;In order to use correct and;precise terminology, define;the follow terms from table;9.1;Microbiology;Chapter 9-Controlling Microbial Growth in the;Environment;Term;Definition;Example;Sterilization;Aseptic;Disinfection;(Disinfectan;t);Antisepsis;(Antiseptic);Degerming;Sanitization;Pasteurizati;on;-Stasis/static;-cide/cidal;How is sterilization different;from disinfection?;Page 20 of 28;How is disinfection different;from antisepsis?;Give an example of;degerming.;Give an example of;sanitization.;What types of products use;pasteurization?;CRITICAL THINKING: A student inoculates Escherichia coli;into two tubes containing the same sterile liquid medium;except the first tube also contains a drop of a chemical with an;antimicrobial effect. After 24 hours of incubation, the first tube;remains clear, whereas the second tube has become cloudy with;bacteria. Design an experiment to determine whether this;amount of the antimicrobial chemical is bacteriostatics or;bactericidal against E. coli.;ANSWER=;Refer to Figure 9.1. How;many minutes are required;for sterilization if a;microbicidal agent killed;90% microbes per minute?;What are the 5 major targets;of antimicrobial agents?;Action of Antimicrobial Agents;1.;2. Cell membranes;3.;4. Damage to Nucleic Acids;5. Inhibition of metabolism;What happens if a cell's;membrane is damaged?;What happens if the;envelope of a virus is;damaged?;Page 21 of 28;What happens if a cell's;proteins are damaged?;CRITICAL THINKING: Would you expect Gram-negative or;Gram-positive bacteria to be more susceptible to antimicrobial;chemicals that act against cell walls? Explain your answer;which you should base solely upon the nature of the cells;walls.;ANSWER=;Ideally;List and briefly describe the;3 factors to consider in;selecting a microbial control;method.;The Selection of Microbial Control Methods;Ideally, agents used for the control of microbes should be;fast-acting, and;during storage. Further a perfect agent would control the;growth and reproduction of every type of microbe while being;harmless to _____________________________________.;Does such an agent exist?;Factors Affecting the Efficacy of Antimicrobial Methods;1.;2.;3.;Fill in the following chart;which lists microbes and;their relative susceptibilities;to microbial control.;Relative Susceptibility of Microorganisms;Most resistant;Prions;Mycobacteria;Active stage protozoa;Fungi;Nonenveloped viruses;Enveloped viruses;Most susceptible (Least resistant);Figure 9.2-Why are nonenveloped viruses general more;Page 22 of 28;resistant than enveloped viruses?;We've learned in class that bacterial endospores like;Bacillus anthracis or Clostridium difficile, C. botulinum, C.;tetani or C. perfringens are hard to disinfect. What kinds of;conditions can they withstand for how much time?;Why are bacteria in the genus, Mycobacterium (like M.;tuberculosis) so hard to kill?;Environmental conditions;that can affect microbial;death rates and the efficacy;(effectiveness) of;antimicrobial methods;include;1. temperature;2. pH;3. organic materials such as fat, feces, vomit, blood and;biofilms can interfere with the penetration of heat;chemicals and some forms of radiation and therefore objects;need to be cleaned well before sterilization and disinfection;can be done.;Methods for Evaluating Disinfectants and Antiseptics;Is it important to know how;well a particular disinfectant;works against a certain;microbe? Why or why not?;Read Emerging Diseases;Case Study about;Acantamoeba keratitis on;pp. 263;It's imperative to know if an;object needs to be sterile or;disinfected.;Which do you think is more;expensive?;There are two main ways to control microbes;1. Physical methods;2. Chemical methods;Would you like sterilized or disinfected dental instruments;used in your mouth during your dental cleaning?;Sterilization or disinfection?;Page 23 of 28;Another important factor to;Could you put a plastic petri dish in the autoclave and still;consider in selecting a;use it? Why or why not?;microbial control strategy is;the object you are sterilizing.;Complete the chart regarding;Physical Methods of;Microbial Control;Physical Methods of Microbial Control;Table 9.4 (pg. 271);Method;Conditions;Representative use(s);1. Boiling;(Moist;heat);2.;Autoclavin;g (pressure;cooking);(moist;heat);3.;Pasteurizat;ion (moist;heat);4. ultra;high temp;(UHT);sterilizatio;n;(moist;heat);5. hot air;(dry heat);6.;incineratio;n (dry;heat);7.;Page 24 of 28;refrigerati;on;8. Freezing;9.;Dessication;(drying);10.;Lyophilizat;ion (freezedrying);11.;filtration;12. osmotic;pressure;13. ionizing;radiation;14.;nonionizin;g radiation;Do refrigeration and freezing;achieve sterilization?;Does pasteurization achieve;sterilization?;Page 25 of 28;Read Beneficial Microbes;Hard to Swallow? On pp.;273 and give your opinion.;Complete the chart regarding;Chemical Methods of;Microbial Control.;Chemical Methods of Microbial Control;Table 9.5 (pg. 277);Method;Level of;Some use(s);Activity;1. Phenol;2.;Phenolics;3. Alcohols;4.;Halogens;(iodine;chlorine;bromine;fluorine);5.;Oxidizing;agents;(peroxides;ozone;peracetic;acid);6.;Surfactant;s (soaps;and;detergents);7. Heavy;metals;(Arsenic;zinc;Page 26 of 28;mercury;silver;copper;etc.);8.;Aldehydes;(formaldeh;yde and;glutaralde;hyde);9. Gaseous;agents;(ehylene;oxide);10.;Enzymes;Which of these chemical;methods of microbial control;can achieve sterilization?;Antibacterial Soap: Too much of a good thing? (pg. 281);What is the concern that;overuse of antimicrobials;contributes to?;Short Answer and Critical;Thinking;Why are alcohols more;effective in a 70% solution;than in a 100% solution?;How can campers effectively;treat stream water to remove;pathogenic protozoa;bacteria and viruses?;Page 27 of 28;Page 28 of 28


Paper#15719 | Written in 18-Jul-2015

Price : $57