Details of this Paper

Short regions of DNA sequence from four different organisms

Description

solution


Question

Microbiology/biology problem set;Attachment Preview;401_PS4_043014_update 1.doc Download Attachment;Problem Set 4;1. Short regions of DNA sequence from four different organisms are shown below.;Organism;Organism;Organism;Organism;A;B;C;D;AGGTAAGTTACATTTGCAAGCTCTATTGACGCCC;AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCC;AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCC;AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC;Here are the same sequences aligned below for you to highlight their differences in sequence;A) Strictly on the basis of these sequences (i.e. extent of homology) briefly describe the;phylogenetic relationship of these three organisms (i.e - which are the more closely or;distantly related);B) Draw a rooted tree that illustrates your conclusions. (Use Fig. 17.17 in your text and the;Phylogenetic Trees animation in the chapter 17 section of iLearn as guides for how to;proceed with this part.);C) Assume that the sequences above were obtained from 16s rRNA genes and that the percent;sequence similarity you determined for these short sequences is the same as that for the;entire 16s rRNA coding regions. Additionally, assume that: 1) further analysis reveals that;several orthologous genes have the same percent similarity that you saw in the SSU analysis;and 2) total genomic DNA hybridization analysis reveals the percent similarity shown in the;table below. Using the working definition of a species described in section 17.5 of the class;textbook (3rd edition) and the guidelines in Figure 1 below, complete the table below.;NOTE: the guidelines in the textbook are more up-to-date and take more factors into;consideration than the guidelines in Figure 1, which are based solely on DNA hybridization;Problem Set 4;data. Therefore, the guidelines in section 17.5 should take preference in cases where the;two methods lead to alternative results.;Organisms A and D;% similarity;(DNA hybridization);20;Organisms C and D;79;Organisms B and D;Same genus?;Same species?;71;D) Based on the data in part C above;i) Which pair of organisms would you expect to have the highest degree of nucleotide;similarity in their informational genes (as discussed in section 17.3)?;ii) Which pair has the highest degree of nucleotide similarity in their operational genes?;2. The purple phototrophic bacteria and the cyanobacteria can both generate energy by;photosynthesis but differ physiologically and ecologically in the way they do it. Which of;these two photosynthetic organisms has remained more metabolically and ecologically similar;to their last common ancestor? Explain the reasoning behind your answer. (4 points);Problem Set 4;3. Eukaryotic cells are generally more highly compartmentalized than prokaryotic cells. In;addition to the nucleus, eukaryotes contain a number of subcellular membrane-enclosed;organelles in the cytoplasm including, the endoplasmic reticulum, the Golgi, endosomes;hydrogenosomes, lysosomes, mitochondria, peroxisomes and, in photosynthetic organisms;chloroplasts. Additionally, eukaryotic cells also contain transport vesicles that move cargo;among particular organelles and secretory vesicles that deliver cargo to the cytoplasmic;membrane.;For each of the proteins below, list all of the subcellular organelles (indicated in bold type;above) involved in its expression and targeting. For example, for the expression of a;cytoplasmic protein, the mRNA for the gene encoding it is transcribed in the nucleus and;transported to the cytoplasm where the protein is translated and released, so an appropriate;answer would be: nucleus and cytoplasm. The material in your textbooks appendix A2.4;should be helpful in answering these following questions.;A.;B.;C.;D.;a protein that is secreted from the cell;a lysosomal protein;a nuclear protein;the envelope glycoprotein (env) of HIV-1;In which compartments do the following processes occur?;E. oxidative phosphorylation;F. hydrolysis of macromolecules (such as proteins, fats and carbohydrates) that are taken up;from the extracellular space by endocytosis or phagocytosis;G. photosynthesis;H. oxidation of pyruvate;I. transcription;J. glycosylation of proteins;K. sorting of proteins to appropriate organelles such as lysosomes

 

Paper#16412 | Written in 18-Jul-2015

Price : $52
SiteLock