Details of this Paper

One of the NASA land rovers returns from its mission with a variety of samples

Description

solution


Question

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.;test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

 

Paper#18388 | Written in 18-Jul-2015

Price : $32
SiteLock