Details of this Paper

transcription and translation

Description

solution


Question

BIOL 150 Homework 5, transcription and translation;1. Shown below is the sequence is a piece of DNA from chromosome 1 that contains a small gene;5 TGTCGCGCGCGGATATGAGACCCCTACGGGATATATTAGTTTACGCCCG;GCG3;3;ACAGCGCGCGCCTATACTCTGGGGATGCCCTATATAATCAAATGCGGGC;CGC5;The Promoter is;5CGCGCGCGG3;3GCGCGCGCC5;The Terminator is;5GCCC3;3CGGG5;Introns: mRNA sequence 5CCCC3 and 5AUAUAU3;a.;In the space provided above, write the sequence of nucleotides in the pre-mRNA that would be;formed from this piece of DNA. Assume that the transcribed gene starts immediately after the;promoter. Be sure to indicate the 5 and 3 ends of your mRNA.;b.;Now write the sequence of nucleotides that would be found in the mature mRNA that would be;formed. Be sure to indicate the 5 and 3 ends of your mRNA. Remember, the intron sequences;are given above, and you need to remember the difference between pre- and mature mRNA.;c.;What is the amino acid sequence of the protein produced by this gene? We didnt get a chance to;do this in class, but now that you have your mature mRNA, you should be able to translate it.;Find your start codon and then write down series of amino acids that are coded for by each of the;codons that comes after the start codon. (Use the codon chart in your notes or in your book to;complete this problem.);d.;Label the start codon and the stop codon on your mature mRNA strand.;Now we are going to investigate what happens when a mutation occurs in your DNA. Below I have copied the;DNA that you used on the first page of this homework. You should already have figured out the sequence of;amino acids that this DNA codes for.;Normal DNA;5 TGTCGCGCGCGGATATGAGACCCCTACGGGATATATTAGTTTACGCCCG;GCG3;3;ACAGCGCGCGCCTATACTCTGGGGATGCCCTATATAATCAAATGCGGGC;CGC5;Lets assume that a base pair substitution mutation occurs. So the C-G base pair circled in the normal DNA;gets replaced by a G-C base pair, shown in the mutated DNA;Mutated DNA;5 TGTCGCGCGCGGATATGAGACCCCTAGGGGATATATTAGTTTACGCCCG;GCG3;3;ACAGCGCGCGCCTATACTCTGGGGATCCCCTATATAATCAAATGCGGGC;CGC5;Follow the same procedure you used on the first page of this homework to determine the sequence of amino;acids that the mutated DNA codes for (use the same promoter, terminator and introns as on the previous page).;After determining the sequence of amino acids, answer the following question;Will a silent, missense, nonsense or frameshift mutation result? Explain your answer.

 

Paper#18437 | Written in 18-Jul-2015

Price : $32
SiteLock