Description of this paper

Consider the two samples of DNA shown below-single strands are shown for simplicity

Description

solution


Question

Question;Consider the two samples of DNA shown below-single strands are shown for simplicity:Sample#1:CAGTGATCTCGAATTCGCTAGTAACGTTSample#2:TCATGAATTCCTGGAATCAGCAAATGCAIf both samples are treated with the restriction enzyme EcoRI (recognition sequence GAATTC), indicate the number of fragments and the size of each fragment from each sample of DNA.

 

Paper#62551 | Written in 18-Jul-2015

Price : $22
SiteLock